nov., a novel nitrogen-fixing, sulfur-oxidizing gammaproteobacterium isolated from a salt marsh. A high‐potential nonheme iron protein (HiPIP)‐linked, thiosulfate‐oxidizing enzyme derived from, Insights into the stress response and sulfur metabolism revealed by proteome analysis of a, PCR mediated recombination and mutagenesis: SOEing together tailor‐made genes, Phylogenetic taxonomy of the family Chlorobiaceae on the basis of 16S RNA and, The sulfur cycle of freshwater sediments: role of thiosulfate, Evidence for two pathways of thiosulfate oxidation in, Cyanolysis and spectrophotometric estimation of trithionate in mixture with thiosulfate and tetrathionate, On the enzymatic system thiosulfate‐cytochrome. At the latter pH, activity was identical in 100 mM acetate and 100 mM phosphate buffer. SoxCD oxidizes the remaining sulphane sulphur, acting as a sulphur dehydrogenase. The apparent molecular mass of the enzyme was determined by gel filtration on Sephadex 75 (Amersham Pharmacia Biotech, Uppsala, HiLoad 16/60) equilibrated with 50 mM TrisHCl containing 150 mM NaCl, pH 7.5 (flow rate 0.5 ml min−1). In conjunction with its localization in the bacterial periplasm, the low pH optimum of 4.25 for the A. vinosum thiosulphate dehydrogenase is in full agreement with the observation that whole cells preferably form tetrathionate from thiosulphate at pH values below 7.0 while sulphate is the main product under alkaline conditions (Smith, 1966; Smith and Lascelles, 1966). Bound protein was eluted by decreasing the (NH4)2SO4 concentration in a linear gradient of 550 ml (2.5 ml min−1). SDS‐PAGE (15%) and immunochemical analysis of purified SoxXA, SoxB and SoxYZ from A. vinosum. When large amounts of A. vinosum cell material were required for protein purification the medium (‘thiosulphate medium’) was prepared as follows (for 10 l of medium): 100 ml of 100× macro element solution [100 g of KH2PO4, 70 g of NH4Cl, 40 g of MgSO4 × 7 H2O, 10 g of CaCl2 × 2 H2O, 100 ml of 10× trace element solution SL12 (Pfennig and Trüper, 1992), and 193 ml of 37% HCL in a final volume of 500 ml] diluted to 9500 ml to give solution 1, and 500 ml of solution 2 containing 26.5 g of Na2CO3, 21 g of NaHCO3, 31 g of Na2S2O3 × 5 H2O and 25 ml of sulphide solution (74 g of HNaS × 1 H2O l−1). In P. pantotrophus the Sox complex is essential for thiosulphate oxidation in vivo and catalyses a reduction of cytochrome c coupled to the oxidation of thiosulphate, sulphide, sulphite and elemental sulphur in vitro. We conclude that this protein is a contamination of thiosulphate dehydrogenase that we could not completely remove from our preparations. The inactivation of soxY in the corresponding mutant ΔsoxY was achieved by in‐frame mutagenesis, making use of splicing by overlap extension PCR (SOEing PCR; Horton, 1995), with the primers Yforward (5′‐aggccgtctagaatttccgtgacacattgc‐3′), Ysoe‐reverse (5′‐tcttatagagcttgttgatttatctcctct‐3′), Ysoe‐forward (5′‐agaggagataaat caacaagctctataaga‐3′) and Yreverse (5′‐tgcgcctctagaggctggtttcgaattcta‐3′). After gel filtration, SoxA was detected in fractions corresponding to an apparent molecular weight of 40 kDa. For activity staining, gels after native PAGE were incubated in substrate solution [100 mM acetate buffer, pH 5.0, 8 mM Na2S2O3, 1 mM K3Fe(CN)6] for 30 min at room temperature, rinsed with destilled water and incubated in 10 mM FeCl3. Using the same soxB probe further positive clones with a 4.5 kb SphI/SmaI insert were selected from a library of 4–5 kb SphI/SmaI fragments of chromosomal DNA in the pGEM7 Zf(+) vector. Gel filtration yielded an apparent molecular mass of 38 kDa indicating that the protein is present as a monomer. RNA Stabilization Directly and Comprehensively Revealed Episymbiotic Microbial Communities of Deep-Sea Squat Lobsters The inactivation of ORF9/rhd, situated downstream of soxA, had no detectable effect on thiosulphate degradation (data not shown). Most phototrophic and chemotrophic sulphur oxidizers are able to use thiosulphate. Native PAGE revealed the presence of one strong band that was identified as thiosulphate dehydrogenase by activity staining (Fig. The sulphide production rates from both thiosulphate and sulphite were found to be considerably higher than those from sulphate ( Nielsen, 1991 ). It occurs in a number of facultatively chemo‐ or photolithotrophic organisms like Paracoccus pantotrophus or Rhodovulum sulfidophilum (Appia‐Ayme et al., 2001; Friedrich et al., 2001; 2005). Interestingly, for all these organisms the formation of sulphur globules as intermediates of reduced sulphur compound oxidation is well established (Dahl and Prange, 2006). After stirring for 5 min on ice denatured protein was removed by centrifugation (25 000 g, 4°C, 20 min) and the pH was increased back to pH 7.5 by addition of a 1 M Tris base solution followed by addition of (NH4)2SO4 to 1.2 M. After incubation on ice for 10–16 h, precipitated protein was removed by centrifugation (25 000 g, 4°C, 30 min). Two pathways for thiosulfate oxidation in the alphaproteobacterial chemolithotroph Paracoccus thiocyanatus SST. All activity determinations were taken as the mean of three measurements. Evidence for Niche Partitioning Revealed by the Distribution of Sulfur Oxidation Genes Collected from Areas of a Terrestrial Sulfidic Spring with Differing Geochemical Conditions. In the complementation strain ΔsoxY+Y the principal capability to oxidize thiosulphate to sulphate was clearly re‐established (Fig. Thawed cell material was resuspended in stabilizing buffer [50 mM potassium phosphate buffer with 2 mM sodium thiosulphate, 1 mM magnesium sulphate and 1 μM phenylmethylsulphonylfluoride (PMSF), pH 7.5] at a ratio of 3 ml of buffer per gram wet weight. As nouns the difference between thiosulphate and sulfate is that thiosulphate is a salt of thiosulphuric acid while sulfate is (organic chemistry) any ester of sulfuric acid. The apparent molecular mass of the eluted proteins was determined by calibrating the column with standard proteins (Sigma Marker low‐range; molecular mass 6500–66 000 Da). The Sox system is found in green sulphur bacteria like C. tepidum as well as in different groups of Proteobacteria and the thermophilic bacterium Aquifex aeolicus (Petri et al., 2001; Friedrich et al., 2005). For the purification of SoxYZ, chromatography on MonoQ was omitted. This structure could function as transcription terminator; however, poly(T) sequences located directly downstream of such hairpin loops in typical eubacterial rho‐independent transcription terminators (Reynolds et al., 1992) are not present. The intermediary formation of sulphur globules in A. vinosum appears to be related to the lack of soxCD genes, the products of which are proposed to oxidize SoxY‐bound sulphane sulphur. Compositions and Abundances of Sulfate-Reducing and Sulfur-Oxidizing Microorganisms in Water-Flooded Petroleum Reservoirs with Different Temperatures in China. . For SoxA a thiosulphate‐dependent induction of expression, above a low constitutive level, was observed. Diversity of Sulfur-Oxidizing and Sulfur-Reducing Microbes in Diverse Ecosystems. Combined fractions containing the enzyme were loaded onto a pre‐packed MonoQ HR 5/5 column equilibrated with 20 mM TrisHCl, pH 7.5. Formation of SoxA in A. vinosum appeared to be thiosulphate‐inducible above a low constitutive level, consistent with a role in the utilization of thiosulphate. Taking the polar effect of the inserted resistance cassette into consideration, the observed phenotypes cannot be assigned to one single deleted sox gene. However, in organisms like A. vinosum that lack the ‘sulphur dehydrogenase’ SoxCD the sulphane sulphur atom still hooked up to SoxY cannot be directly further oxidized. The reaction was stopped by transfer of the gels into 7% acetic acid. During the past several years data accumulated that cast further doubt on an important role of rhodanese or thiosulphate reductase during thiosulphate oxidation in sulphur‐storing bacteria: Clusters of sox genes were identified in thiosulphate‐oxidizing green sulphur bacteria (Eisen et al., 2002; Vertéet al., 2002) and PCR analyses proved the existence of the highly conserved soxB gene also in other thiosulphate‐utilizing but not in non‐thiosulphate‐utilizing strains of green sulphur bacteria (Petri et al., 2001). Metabolic inhibition of iodide transport in choroid plexus and ciliary body by tellurium and selenium. In this work we have shown unambiguously that sox‐encoded proteins are absolutely essential for the oxidation of thiosulphate to sulphate in A. vinosum. The soxXΩKm complementing plasmid pΔsoxX+X contained a 4.5 kb ApaI/SpeI fragment of A. vinosum DNA including besides part of soxB, the complete soxXA, ORF9, and rhd genes as well as the soxBX intergenic region with the potential promoter region. Under neutral to slightly acidic growth conditions A. vinosum oxidizes part of the thiosulphate present to tetrathionate. The corresponding fractions were combined, concentrated to keep the total volume below 2 ml, and further purified by gel filtration on Superdex TM200 equilibrated with gel filtration‐stabilizing buffer (50 mM TrisHCl, 2 mM sodium thiosulphate, 1 mM magnesium sulphate, 1 μM PMSF, pH 7.5) containing 150 mM NaCl (flow rate 0.5 ml min−1).